Notes:
For integration of large DNA segments, Lox-pegRNAs were designed to insert LoxAR2 into specific genomic regions. RT sequence of LoxAR2-pegRNA1: AAATGTATGCTATACGAAGTTAT; RT sequence of LoxAR2-pegRNA2: TAGCATACATTTTCCGATGTTAT.
Notes:
For large-scale DNA deletions, Lox-pegRNAs were designed to insert LoxAR2 and Lox71 upstream and downstream of the deletion region. RT sequence of LoxAR2-pegRNA1: AAATGTATGCTATACGAAGTTAT; RT sequence of LoxAR2-pegRNA2: TAGCATACATTTTCCGATGTTAT; RT sequence of Lox71-pegRNA1: TAATGTATGCTATACGAACGGTA; RT sequence of Lox71-pegRNA2: TAGCATACATTATACGAAGTTAT.
Notes:
For large-scale DNA inversions, the pegRNAs were positioned upstream and downstream of the inversion region for inserting LoxAR2 and rLox71. RT sequence of LoxAR2-pegRNA1: AAATGTATGCTATACGAAGTTAT; RT sequence of LoxAR2-pegRNA2: TAGCATACATTTTCCGATGTTAT; RT sequence of rLox71-pegRNA1: TAGCATACATTATACGAAGTTAT; RT sequence of rLox71-pegRNA2: TAATGTATGCTATACGAACGGTA.
Notes:
For large-scale DNA replacement, Lox-pegRNAs were designed upstream and downstream of the segments to be replaced, to insert LoxAR2 and ODLoxAR2. RT sequence of LoxAR2-pegRNA1: AAATGTATGCTATACGAAGTTAT; RT sequence of LoxAR2-pegRNA2: TAGCATACATTTTCCGATGTTAT; RT sequence of ODLoxAR2-pegRNA1: AAAAGTATCCTATACGAAGTTAT; RT sequence of ODLoxAR2-pegRNA2: TAGGATACTTTTTCCGATGTTAT.
Notes:
For chromosomal translocations, Lox-pegRNAs were designed to insert LoxAR2 and Lox71 at specific sites on the two chromosomes involved. RT sequence of LoxAR2-pegRNA1: AAATGTATGCTATACGAAGTTAT; RT sequence of LoxAR2-pegRNA2: TAGCATACATTTTCCGATGTTAT; RT sequence of Lox71-pegRNA1: TAATGTATGCTATACGAACGGTA; RT sequence of Lox71-pegRNA2: TAGCATACATTATACGAAGTTAT.
Notes:
The PCE system produces large-scale DNA edits that leave Lox sequences on the genome. Large DNA integrations leave residual LoxP at the 5‘ terminal and Lox71/AR2 at the 3’ terminal; large DNA deletions leave residual LoxP in the genome; large DNA inversions leave residual LoxP at the 5‘ terminal and residual rLox71/AR2 (inverted Lox71/AR2) at the 3’ terminal; large DNA replacements result in residual LoxP at the 5‘ terminal and residual ODLoxP at the 3’ terminal; chromosomal translocations result in residual LoxP on the first chromosome and residual Lox71/AR2 on the second chromosome. Researchers need to input the residual Lox and the flanking genomic sequences on this page to generate target sites, and further design appropriate RT template to construct Re-pegRNAS.
